Dichlorodioctylstannane

Specific investigations: other studies

Administrative data

Endpoint:

specific investigations: other studies

Type of information:

experimental study

Adequacy of study:

key study

Study period:

2012

Reliability:

2 (reliable with restrictions)

Rationale for reliability incl. deficiencies:

other: no glp information, no guideline, well documentated

Data source

Reference

Reference Type:

publication

Title:

Unnamed

Year:

2012

Report date:

2012

Materials and methods

Test guideline

Qualifier:

no guideline available

Principles of method if other than guideline:

2. Materials and methods
2.1. Materials
Cadmium chloride was purchased from Merck KGaA (Darmstadt, Germany),
[1,2,6,7-3H]-cortisol from Amersham Pharmacia (Piscataway, NJ, USA), unlabeled
steroids from Steraloids (Newport, RI), and all other chemicals and cell culture
medium from Sigma–Aldrich Chemie GmbH (Buchs, Switzerland). The solvents were
of analytical and high performance liquid chromatography grade and the reagents
of the highest grade available. Cadmium chloride, thiram and organotins were dissolved
in dimethyl sulfoxide (DMSO) and stored as 20 mM stock solution at
−20 ◦C.
N-ethylmaleimide (NEM) was dissolved in ethanol and stored as 20 mM stock solution
at
−20 ◦C.
2.2. Construction of expression plasmids and site-directed mutagenesis
Expression plasmids for human wild-type 11-HSD2 and mutant C264S have
been described earlier (Atanasov et al., 2005; Odermatt et al., 1999). A full length
zebrafish (danio rerio) cDNA clone was purchased from ImaGenes GmbH, RZPD,
Berlin, Germany. The cDNA was amplified by PCR using an oligonucleotide at the
start codon to introduce a BamHI endonuclease restriction site and a Kozak consensus
sequence (5-CATAAGCTTCCGCCATGTCTATTTTTGTTGGTGGAGCAG-3) and an
oligonucleotide at the stop codon either to add an XbaI endonuclease restriction site
(5-ACCTCGAGCTAATCAATACACTTTGTGAAGTTGC-3) or to attach a FLAG-epitope
followed by the stop codon and an XbaI endonuclease restriction site (5-
ACCTCGAGTCACTTGTCATCGTCGTCCTTGTAGTCCATAGAACCATCAATACACTTTGTGAAGTTGCTG-
3). The PCR product was inserted into the BamHI–XbaI sites of the
pcDNA3.1 vector. Site-directed mutagenesis to construct mutant A253C was
performed as described earlier (Atanasov et al., 2005). The selected clones used
in this study were sequence verified. Protein expression and enzyme activity
was assessed in transiently transfected HEK-293 cells. Protein expression of
zebrafish wild-type 11-HSD2 and mutant A253C was verified by Western blotting
(Fig. S1), as described for human 11-HSD2 wild-type and mutant C264S (Atanasov
et al., 2005). Briefly, proteins were separated by sodium dodecyl sulfate gel electrophoresis
and transferred on a polyvinyl difluoride membrane. The FLAG-tagged
11-HSD2 was detected by mouse M2 antibody from Sigma–Aldrich Chemie GmbH.
Actin was detected by rabbit anti-actin IgG from Santa Cruz Biotechnology Inc.
(Santa Cruz, CA, USA). Horseradish peroxidase-conjugated secondary antibodies
were used to visualize the bands with Immobilon Western Chemiluminescent
HRP substrate from Millipore Corporation (Billerica, MA, USA). Untagged and
C-terminally FLAG-epitope tagged proteins showed comparable activities as seen
before for human 11-HSD2 expression constructs (Odermatt et al., 1999).
2.3. Cell culture
Human embryonic kidney cells (HEK-293) were cultivated in Dulbecco’s modified
Eagle’s medium (DMEM) containing 4.5 g/L glucose (D5796 Sigma–Aldrich),
10% fetal bovine serum, 100 U/mL penicillin, 0.1 mg/mL streptomycin, 1×
MEM nonessential
amino acids and 10 mM HEPES buffer, pH 7.4. Cells were incubated at 37 ◦C
in a humidified 5% CO2 atmosphere.
Zebrafish embryonic fibroblast cells ZF-4 (kindly provided by Dr. Jerzy Adamski,
Helmholtz Zentrum, Munich, Germany) were cultivated in DMEM:F12 (D8437
Sigma–Aldrich), supplemented with 10% fetal bovine serum, 100 U/mL penicillin
and 0.1 mg/mL streptomycin. These cells were maintained at 28 ◦C in a humidified
5% CO2 atmosphere.
2.4. Transient transfection and harvesting of cells
HEK-293 cells were transiently transfected with plasmids for human wild-type
11-HSD2 (Odermatt et al., 1999) or mutant C264S (Atanasov et al., 2005) using the
calcium phosphate precipitation method. Transfection efficiency was approximately
20%. Zebrafish wild-type 11-HSD2 and mutant A253C were transfected into ZF-4
cells using Fugene HD according to the manufacturer’s protocol (Roche Applied Science,
Rotkreuz, Switzerland). Transfection efficiency was approximately 25%. After
48 h transfected cells were detached, centrifuged and cell pellets (5 pellets/10 cm2
dish) shock frozen on dry ice and stored at
−80 ◦C until further use.
2.5. Determination of recombinant human, mouse and zebrafish 11ˇ-HSD2
activities by liquid chromatography–tandem mass spectrometry (LC–MS)
Reactions were performed for 10 min at 37 ◦C in a total volume of 500 L containing
lysates of HEK-293 cells expressing human, mouse or zebrafish 11-HSD2
in buffer TS2 (100 mM NaCl, 1 mM EGTA, 1 mM EDTA, 1 mM MgCl2, 250 mM sucrose,
20 mM Tris–HCl, pH 7.4), supplemented with 500 M NAD+ and the corresponding
substrate (2 nM–2 M final concentration). Internal standard (100 nM deuterized
d8-corticosterone) was added, followed by extraction with 1 mL ethyl acetate. The
organic phase was transferred to a new tube, evaporated to dryness and reconstituted
in 100 L of methanol containing 0.1% formic acid.
Steroids were resolved on an Atlantis T3 (3 m, 2.1 mm
×
150 mm) column
(Waters, Milford, MA) at 30 ◦C using an Agilent model 1200 Infinity Series chromatograph
(Agilent Technologies, Basel, Switzerland). The mobile phase consisted
of water and acetonitrile (95:5) containing 0.1% formic acid (solvent A), and water
and acetonitrile (5:95) containing 0.1% formic acid (solvent B) at a total flow rate
of 0.4 mL/min. A linear gradient was used starting from 30% solvent B to 70% solvent
B from 0 to 13 min, followed by 95% solvent B for 2 min, and re-equilibration
with 30% solvent B. A built-in switching valve was used to direct the LC flow to an
Agilent 6410 triple quadrupole MS (controlled by Mass Hunter workstation software
version B.01.04). The injection volume of each sample was 5 L. The MS was
operated in atmospheric pressure electrospray positive ionization mode, with nebulizer
pressure and nebulizer gas flow rate of 45 psi and 10 L/min, respectively, a
source temperature of 350 ◦C and capillary and cone voltage of 4000 V and 190 V,
respectively.
The six steroids were analyzed using multiple-reaction monitoring (MRM).
Metabolites were identified by comparing their retention time and mass to charge
ratio (m/z) with those of authentic standards. The transitions, collision energy
and retention time were m/z 363/121, 25 V, 11.4 min for cortisol; m/z 361/163,
20 V, 11.6 min for cortisone; m/z 347/121, 40 V, 13.4 min for corticosterone; m/z
355/125, 28 V, 13.4 min for d8-corticosterone; m/z 345/121, 40 V, 12.9 min for
11-dehydrocorticosterone; m/z 305/121, 20 V, 12.3 min for 11-
hydroxytestosterone; and m/z 303/121, 24 V, 12.5 min for 11-ketotestosterone.
2.6. Determination of inhibition of human and zebrafish 11ˇ-HSD2
Enzyme activity was measured using cell lysates as described previously
(Kratschmar et al., 2011). Briefly, cell pellets were resuspended in TS2 buffer and
sonicated using a Branson sonicator (5 pulses, output 2, duty cycles 20, performed at
4 ◦C). Lysates were incubated for 10 min at 37 ◦C in a total volume of 22 L containing
10 nM [1,2,6,7-3H]-cortisol, 40 nM unlabeled cortisol, 500 M NAD+ and either vehicle
or inhibitor. To assess the inhibition by Cd2+, TS2 buffer without EGTA and EDTA
was applied. Reactions were stopped by adding an excess of cortisone and cortisol
(2 mM) in methanol. Separation of the steroids was performed by thin layer chromatography
(TLC) and product formation was determined by scintillation counting.
In all experiments conversion of cortisol to cortisone was kept below 30%. IC50 values
were calculated by non-linear regression using four parametric logistic curve fitting
(GraphPad Prism). Data (mean
±
SD) were obtained from at least three independent
experiments.

GLP compliance:

not specified

Type of method:

in vitro

Endpoint addressed:

other: gene expression (blacenta barrier)

Test material

Test material information

Constituent 1

Reference substance name:

Dioctyltin do not affect 11beta-HSD2 (placenta barrier) of human and zebrafish

IUPAC Name:

Dioctyltin do not affect 11beta-HSD2 (placenta barrier) of human and zebrafish

Test material form:

other: emulsion

Test animals

Species:

other: Human, zebrafish

Strain:

other: Human embryonic kidney cells (HEK-293), Zebrafish embryonic fibroblast cells ZF-4

Sex:

not specified

Administration / exposure

Route of administration:

other: not relevant

Vehicle:

other: not relevant

Analytical verification of doses or concentrations:

yes

Duration of treatment / exposure:

10 min

Frequency of treatment:

1 time

Post exposure period:

analysis of 11beta-HSD2 inhibition

Doses / concentrations

Remarks:

Doses / Concentrations:
50 µM
Basis:
analytical conc.

No. of animals per sex per dose:

not relevant

Control animals:

yes

Results and discussion

Details on results:

Dioctyltin do not affect 11beta-HSD2 of human and zebrafish

According to Seckl et al. (2004) 11beta-HSB2 forms a placenta barrier to avoid transfer from maternal glucorticoid steroide to the fetus. Transfer of maternal glucorticoid steroide to the fetus results in altered foetal growth and development, and later pathophysiology

Any other information on results incl. tables

see publication

Applicant's summary and conclusion

Conclusions:

Dioctyltin do not affect 11beta-HSD2 (placenta barrier) of human

According to Seckl et al. (2004) 11beta-HSB2 forms a placenta barrier to avoid transfer from maternal glucorticoid steroide to the fetus. Transfer of maternal glucorticoid steroide to the fetus results in altered foetal growth and development, and later pathophysiology

Executive summary:

Dioctyltin do not affect the placenta barrier of human. The placenta barrier is responsible for aviod the transfer of maternal glucorticoide to the fetus.;ransfer of maternal glucorticoid steroide to the fetus results in altered foetal growth and development, and later pathophysiology